Echinophyllia sp. sc22
WebEchinophyllia sp. sc22 (2) Firefly luc (1) Hiv-1 (2) Homo sapiens (92) Mus musculus (39) Pyrophorus plagiophthalamus (1) Rattus norvegicus (6) Synthetic (56) More Filters . Plasmid Type. Empty backbone (16) … http://www.maltawildplants.com/APIA/Echinophora_spinosa.php
Echinophyllia sp. sc22
Did you know?
WebJan 31, 2024 · Echinophyllia sp. SC22 3 10 2 3 ND 488 405 51 rsFastLime (M) Dronpa [22G] Echinophyllia sp. SC22 52 bsDronpa (M) Dronpa [22G] Echinophyllia sp. SC22 52 rsCherryRev (M) mCherry [DsRed] Discosoma sp. rsTagRFP (M) TagRFP [eqFP578] E. quadricolor 27 mEosFP M159A (M) EosFP L. Hemprichii 3 10 2 3 1.5 3 10 2 1 488 405 41 WebJun 1, 2014 · Likewise, after the discovery of the reversibly switchable asFP595 in Anemonia sulcata, the engineering of monomeric Dronpa from Echinophyllia sp. revolutionized the field, and was followed by the release of many variants opening up a continuously growing panel of applications, from biotechnology to optogenetics. In the …
WebDec 21, 2004 · Disclaimer Any medical or genetic information present in this entry is provided for research, educational and informational purposes only. It is not in any way intended to be used as a substitute for professional … WebLight: Plant Echinops in Full sun. Soil: Echinops can handle many different types of soils so long as they are well drained. Well-drained soils are sandy and loamy soils (most …
WebEchinophyllia sp. SC22 Insert Size (bp) 1642 Mutation. Spontaneous mutation of calmodulin's penultimate residue to a threonine, which does not seem to perturb calcium binding Promoter t7 Tags / Fusion Proteins. A modified TorA periplasmic targeting sequence plus a histidine tag (N terminal on insert) ... WebDiscosoma sp. (sea anemone) (4) Echinophyllia sp. sc22 (1) Gallus gallus (5) Homo sapiens (8) Mus musculus (1) Prokaryotic (4) Rattus norvegicus (9) Synthetic (87) Synthetic construct (7) More Filters . Plasmid Type. Encodes multiple inserts (4) Encodes one insert (110) Resistance Marker. Bleomycin (1)
WebMay 27, 2024 · Phoenix, AZ. Rating - 0%. 0 0 0. "Chalice" is just a common name for these types of corals. Whereas "Echinophyllia" is a scientific genus. There are two genera which make up most of the "chalice" …
WebEchinophyllia sp. SC22. Similar Structures: VAST+. Download sequence data: Biological Unit for 6D38: dimeric; determined by author and by software (PISA) Molecular … stowe mountain house rentalsWebSpecies: Echinophyllia sp. SC22 [TaxId:301887] Gene: Dronpa Database cross-references and differences (RAF-indexed): Uniprot Q5TLG6 (3-End) Domains in SCOPe 2.08: … rotate image using cv2WebEchinophyllia sp. SC22 Taxonomy ID: 301887 (for references in articles please use NCBI:txid301887) current name. Echinophyllia sp. SC22. NCBI BLAST name: stony … stowe mountain lift ticket priceWebEchinophyllia sp. SC22 Insert Size (bp) 825 Promoter EF-1a Tag / Fusion Protein. COX8A mitochondria targeting sequence (N terminal on insert) Cloning Information Cloning method Restriction Enzyme 5′ cloning site EcoRI (not destroyed) 3′ cloning site NotI (not destroyed) 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC 3 ... stowe mountain lift ticket pricesWebEchinophyllia sp. SC22. Similar Structures: VAST+. Download sequence data: Biological Unit for 4HQ8: tetrameric; determined by author and by software (PISA) Molecular Components in 4HQ8; Label Count Molecule; Proteins (4 molecules) A. B. A_1. B_1. 4: Fluorescent Protein Dronpa. stowe mountain hiking trailsWebJan 31, 2024 · Echinophyllia sp. SC22 3 10 2 3 ND 488 405 51 rsFastLime (M) Dronpa [22G] Echinophyllia sp. SC22 52 bsDronpa (M) Dronpa [22G] Echinophyllia sp. SC22 … stowe mountain lift tickets discountWebEchinophyllia sp. Großpolypige Steinkoralle. Echinophyllia tarae Großpoylpige Steinkoralle Author: Meerwasser-Lexikon Team Publisher: Meerwasser-Lexikon.de. ... 2024-11-26 00:32:42 . Captive breeding / propagation. The offspring of Echinophyllia aspera are possible. Unfortunately, the number of offspring is not large enough to cover the ... stowe mountain lift hours